Purification of a fraction of MDM2 for manufacturing of polyclonal antisera.

Purification of a fraction of MDM2 for manufacturing of polyclonal antisera.

A histidine-tagged, carboxy-terminal fragment of the murine double minute 2 gene product, p90(MDM2), was purified by Ni–NTA chromatography and preparative gel electrophoresis. The purified MDM2 fragment was used to generate polyclonal antisera that acknowledge a number of species of MDM2 proteins, together with the inhibitor of p53, p90(MDM2), in addition to the activator of p53, p76(MDM2). The antibodies are helpful for Western evaluation, immunoprecipitation, and immunofluorescence.

 

Autoantibody to MDM2: A Potential Serological Marker of Systemic Lupus Erythematosus.

Introduction. Systemic lupus erythematosus (SLE) is without doubt one of the systemic autoimmune illnesses characterised by the polyclonal autoantibody manufacturing. The human homologue of the mouse double minute 2 (MDM2) is effectively often called the detrimental regulator of p53. MDM2 has been reported to be overexpressed in SLE animal mannequin and to advertise SLE.

Since abnormally expressed proteins can induce autoimmune response, anti-MDM2 autoantibody was examined in SLE sufferers. Strategies. Anti-MDM2 antibody in sera from 43 SLE sufferers and 69 wholesome individuals was investigated by ELISA. Constructive samples had been additional confirmed by western blotting.

 

The immunological feathers of anti-MDM2 constructive sera had been analyzed by oblique immunofluorescence assay. Anti-p53 was additionally investigated in SLE sufferers by ELISA, and the correlation of anti-MDM2 and anti-p53 was analyzed. Outcomes.

 

The presence of anti-MDM2 in SLE sufferers was 23.30%, a lot larger than regular wholesome individuals (4.30%). These anti-MDM2 constructive sera current a nuclear staining sample. The presence of anti-p53 in SLE sufferers was 39.50%, and the titer of anti-MDM2 was positively correlated with anti-p53 in SLE sufferers. Conclusions. Anti-MDM2 autoantibody was detected at excessive prevalence in SLE sufferers. The detection of anti-MDM2 in SLE sufferers must be clinically helpful.

 

 

Mdm2 promotes systemic lupus erythematosus and lupus nephritis.

Systemic lupus erythematosus (SLE) is a polyclonal autoimmune syndrome directed towards a number of nuclear autoantigens. Though RNA and DNA appear to have equivalent immunostimulatory results on systemic and intrarenal irritation, every appears to vary with regard to the propensity to induce mitogenic results resembling lymphoproliferation.

To establish potential mechanisms by which DNA particularly contributes to the pathogenesis of lupus nephritis, we stimulated cells with immunostimulatory DNA or RNA in vitro and used microarray to match the transcriptomes of RNA- and DNA-induced genes. Immunostimulatory DNA, however not RNA, induced Mdm2, which is a detrimental regulator of p53. In vivo, we noticed better expression and activation of Mdm2 within the spleen and kidneys in a mouse mannequin of lupus (MRL-Fas(lpr) mice) than wholesome controls.

 

Therapy of MRL-Fas(lpr) mice with the Mdm2 inhibitor nutlin-3a prevented nephritis and lung illness and considerably extended survival. Inhibition of Mdm2 lowered systemic irritation and abrogated immune complicated illness by suppressing plasma cells and the manufacturing of lupus autoantibodies. As well as, nutlin-3a suppressed the irregular growth of all T cell subsets, together with CD3(+)CD4(-)CD8(-) T cells, which related to attenuated systemic irritation.

 

Nevertheless, inhibiting Mdm2 didn’t trigger myelosuppression or have an effect on splenic regulatory T cells, neutrophils, dendritic cells, or monocytes. Taken collectively, these information recommend that the induction of Mdm2 promotes the growth of plasma cells and CD3(+)CD4(-)CD8(-) T cells, which trigger autoantibody manufacturing and immune complicated illness in MRL-Fas(lpr) mice. Antagonizing Mdm2 might have therapeutic potential in lupus nephritis.

LDLRAD3 Antibody
39887-100ul	SAB	100ul	EUR 390

LDLRAD3 Antibody
CSB-PA786511-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

LDLRAD3 Antibody
CSB-PA786511-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

LDLRAD3 antibody
70R-35512	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal LDLRAD3 antibody

LDLRAD3 antibody
70R-9224	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal LDLRAD3 antibody

LDLRAD3 antibody
70R-51775	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal LDLRAD3 antibody

LDLRAD3 Antibody
1-CSB-PA007326	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LDLRAD3. Recognizes LDLRAD3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/40000

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

LDLRAD3 Conjugated Antibody
C34765	SAB	100ul	EUR 397

LDLRAD3 Polyclonal Antibody
ABP53840-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90 Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 Polyclonal Antibody
ABP53840-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90 Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 Polyclonal Antibody
ABP53840-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90 Applications tips:
Description: A polyclonal antibody for detection of LDLRAD3 from Human, Mouse. This LDLRAD3 antibody is for IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human LDLRAD3 at AA rangle: 10-90

LDLRAD3 Polyclonal Antibody
ES4839-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LDLRAD3 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

LDLRAD3 Polyclonal Antibody
ES4839-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LDLRAD3 from Human/Mouse. This antibody is tested and validated for IF, WB, ELISA

LDLRAD3 siRNA
20-abx922395	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LDLRAD3 siRNA
20-abx922396	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LDLRAD3 Blocking Peptide
33R-1897	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDLRAD3 antibody, catalog no. 70R-9224

LDLRAD3 Blocking Peptide
20-abx162318	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

LDLRAD3 cloning plasmid
CSB-CL803154HU-10ug	Cusabio	10ug	EUR 401
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1038 Sequence: ATGTGGCTGCTGGGGCCGCTGTGCCTGCTGCTGAGCAGCGCCGCGGAGAGCCAGCTGCTCCCCGGGAACAACTTCACCAATGAGTGCAACATACCAGGCAACTTCATGTGCAGCAATGGACGGTGCATCCCGGGCGCCTGGCAGTGTGACGGGCTGCCTGACTGCTTCGACAAGA Show more
Description: A cloning plasmid for the LDLRAD3 gene.

Polyclonal LDLRAD3 antibody - middle region
APR01194G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDLRAD3 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat anti-GST α-form
GST-ANTI-1	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2	Detroit R&D	50 uL	EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3	Detroit R&D	50 uL	EUR 280

Mouse Ldlrad3 ELISA KIT
ELI-27814m	Lifescience Market	96 Tests	EUR 865

Human LDLRAD3 shRNA Plasmid
20-abx965371	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LDLRAD3 shRNA Plasmid
20-abx982528	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LDLRAD3 ELISA KIT
ELI-39778h	Lifescience Market	96 Tests	EUR 824

LDLRAD3 Recombinant Protein (Human)
RP040687	ABM	100 ug	Ask for price

LDLRAD3 Recombinant Protein (Mouse)
RP147182	ABM	100 ug	Ask for price

anti- OCT2-Specific antibody
FNab05962	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: POU class 2 homeobox 2 Uniprot ID: P09086 Gene ID: 5452 Research Area: Cancer, Immunology, Metabolism, Developmental biology
Description: Antibody raised against OCT2-Specific

anti- Oct6-Specific antibody
FNab05965	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: POU class 3 homeobox 1 Uniprot ID: Q86VW1 Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against Oct6-Specific

anti- ORM2-Specific antibody
FNab06014	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IF: 1:50-1:500 Immunogen: orosomucoid 2 Uniprot ID: P19652 Research Area: Cardiovascular
Description: Antibody raised against ORM2-Specific

anti- PACS2-Specific antibody
FNab06099	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:10-1:100 Immunogen: phosphofurin acidic cluster sorting protein 2 Uniprot ID: Q86VP3 Research Area: Cell Division and Proliferation
Description: Antibody raised against PACS2-Specific

anti- Palladin-Specific antibody
FNab06127	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 IP: 1:200-1:1000 Immunogen: palladin, cytoskeletal associated protein Uniprot ID: Q8WX93 Research Area: Neuroscience, Immunology
Description: Antibody raised against Palladin-Specific

anti- PAX1-Specific antibody
FNab06167	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: paired box 1 Uniprot ID: P15863 Research Area: Metabolism, Developmental biology
Description: Antibody raised against PAX1-Specific

anti- PAX8-Specific antibody
FNab06177	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: paired box 8 Uniprot ID: Q06710 Research Area: Cancer, Immunology, Metabolism, Developmental biology
Description: Antibody raised against PAX8-Specific

anti- persephin-Specific antibody
FNab06323	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: persephin Uniprot ID: O60542 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against persephin-Specific

anti- PFKFB3-Specific antibody
FNab06339	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:200 IF: 1:20-1:200 Immunogen: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 Uniprot ID: Q16875 Gene ID: 5209 Research Area: Metabolism
Description: Antibody raised against PFKFB3-Specific

anti- PKM1-specific antibody
FNab06494	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:100-1:400 IF: 1:20-1:200 Immunogen: PKM2 pyruvate kinase, muscle Uniprot ID: P14618 Research Area: Stem Cells, Cancer, Cardiovascular, Metabolism
Description: Antibody raised against PKM1-specific

anti- PKM2-specific antibody
FNab06495	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IP: 1:200-1:1000 IHC: 1:100-1:400 IF: 1:10-1:100 Immunogen: PKM2 pyruvate kinase, muscle Uniprot ID: P14618 Research Area: Stem Cells, Cancer, Cardiovascular, Metabolism
Description: Antibody raised against PKM2-specific

anti- PKM2-specific antibody
FNab06496	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:16000 IP: 1:200-1:1000 IHC: 1:100-1:1000 IF: 1:20-1:200 Immunogen: PKM2 pyruvate kinase, muscle Uniprot ID: P14618 Research Area: Stem Cells, Cancer, Cardiovascular, Metabolism
Description: Antibody raised against PKM2-specific

anti- PLOD2-Specific antibody
FNab06552	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:200-1:1000 IHC: 1:100-1:400 IF: 1:10-1:100 Immunogen: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 Uniprot ID: O00469 Research Area: Metabolism
Description: Antibody raised against PLOD2-Specific

anti- POLR2B-Specific antibody
FNab06620	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:5000 IP: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: polymerase(RNA) II(DNA directed) polypeptide B, 140kDa Uniprot ID: P30876 Research Area: Epigenetics, Metabolism
Description: Antibody raised against POLR2B-Specific

anti- POTEA-Specific antibody
FNab06647	FN Test	100µg	EUR 585
Recommended dilution: IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: POTE ankyrin domain family, member A Uniprot ID: Q6S8J7 Research Area: Cell Division and Proliferation
Description: Antibody raised against POTEA-Specific

anti- POTED-Specific antibody
FNab06648	FN Test	100µg	EUR 585
Recommended dilution: WB 1:500-1:1000 IHC 1:50-1:100 Immunogen: POTE ankyrin domain family, member D Uniprot ID: Q86YR6 Gene ID: 317754 Research Area: Cell Division and Proliferation
Description: Antibody raised against POTED-Specific

anti- POU3F3-Specific antibody
FNab06651	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: POU class 3 homeobox 3 Uniprot ID: P20264 Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against POU3F3-Specific

anti- PPIF-Specific antibody
FNab06676	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:3000 IHC: 1:100-1:400 IF: 1:10-1:100 IP: 1:500-1:2000 Immunogen: peptidylprolyl isomerase F Uniprot ID: P30405 Research Area: Metabolism
Description: Antibody raised against PPIF-Specific

anti- PPP1CB-Specific antibody
FNab06695	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:20-1:200 IP: 1:500-1:2000 Immunogen: protein phosphatase 1, catalytic subunit, beta isoform Uniprot ID: P62140 Research Area: Metabolism, Developmental biology
Description: Antibody raised against PPP1CB-Specific

anti- PPP1R11-Specific antibody
FNab06699	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:1000 Immunogen: protein phosphatase 1, regulatory(inhibitor) subunit 11 Uniprot ID: O60927 Research Area: Metabolism
Description: Antibody raised against PPP1R11-Specific

anti- PSEN2-Specific antibody
FNab06853	FN Test	100µg	EUR 548.75
Recommended dilution: IHC: 1:20-1:200 Immunogen: presenilin 2(Alzheimer disease 4) Uniprot ID: P49810 Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience
Description: Antibody raised against PSEN2-Specific

anti- PTH-Specific antibody
FNab06923	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:1000-1:4000 Immunogen: parathyroid hormone Uniprot ID: P01270 Gene ID: 5741 Research Area: Cancer, Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against PTH-Specific

anti- PYGM-Specific antibody
FNab06977	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: phosphorylase, glycogen, muscle Uniprot ID: P11217 Gene ID: 5837 Research Area: Metabolism
Description: Antibody raised against PYGM-Specific

anti- RAB11B-Specific antibody
FNab06989	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:300-1:600 IHC: 1:20-1:200 Immunogen: RAB11B, member RAS oncogene family Uniprot ID: Q15907 Gene ID: 9230 Research Area: Signal Transduction
Description: Antibody raised against RAB11B-Specific

anti- RAB11-Specific antibody
FNab06994	FN Test	100µg	EUR 505.25
Immunogen: RAB11A, member RAS oncogene family Uniprot ID: P62491 Research Area: Signal Transduction
Description: Antibody raised against RAB11-Specific

anti- RAB22A-specific antibody
FNab07005	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:1000 Immunogen: RAB22A, member RAS oncogene family Uniprot ID: Q9UL26 Research Area: Signal Transduction
Description: Antibody raised against RAB22A-specific

anti- RAB27A-specific antibody
FNab07011	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: RAB27A, member RAS oncogene family Uniprot ID: P51159 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB27A-specific

anti- RAB31-specific antibody
FNab07015	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: RAB31, member RAS oncogene family Uniprot ID: Q13636 Research Area: Signal Transduction
Description: Antibody raised against RAB31-specific

anti- RAB3A-specific antibody
FNab07025	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 IF: 1:10-1:100 Immunogen: RAB3A, member RAS oncogene family Uniprot ID: P20336 Research Area: Signal Transduction
Description: Antibody raised against RAB3A-specific

anti- RAB3C-specific antibody
FNab07028	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IF: 1:10-1:100 Immunogen: RAB3C, member RAS oncogene family Uniprot ID: Q96E17 Research Area: Signal Transduction
Description: Antibody raised against RAB3C-specific

anti- RAB5A-Specific antibody
FNab07039	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:3000 IHC: 1:50-1:500 Immunogen: RAB5A, member RAS oncogene family Uniprot ID: P20339 Gene ID: 5868 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RAB5A-Specific

anti- RAB9A-Specific antibody
FNab07049	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: RAB9A, member RAS oncogene family Research Area: Signal Transduction
Description: Antibody raised against RAB9A-Specific

anti- REDD1 specific antibody
FNab07228	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IP: 1:200-1:2000 IHC: 1:50-1:200 Immunogen: DNA-damage-inducible transcript 4 Uniprot ID: Q9NX09 Gene ID: 54541 Research Area: Epigenetics, Immunology, Cardiovascular
Description: Antibody raised against REDD1 specific

anti- RIM2-Specific antibody
FNab07301	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: regulating synaptic membrane exocytosis 2 Uniprot ID: Q9UQ26 Research Area: Neuroscience
Description: Antibody raised against RIM2-Specific

anti- RIMS4-Specific antibody
FNab07305	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: regulating synaptic membrane exocytosis 4 Uniprot ID: Q9H426 Research Area: Neuroscience
Description: Antibody raised against RIMS4-Specific

anti- RIPK1-Specific antibody
FNab07313	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IP: 1:200-1:1000 IHC: 1:100-1:400 IF: 1:10-1:100 Immunogen: receptor(TNFRSF)-interacting serine-threonine kinase 1 Uniprot ID: Q13546 Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK1-Specific

anti- ROBO1-Specific antibody
FNab07372	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: roundabout, axon guidance receptor, homolog 1(Drosophila) Uniprot ID: Q9Y6N7 Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO1-Specific

anti- ROBO3-Specific antibody
FNab07374	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: roundabout, axon guidance receptor, homolog 3(Drosophila) Uniprot ID: Q96MS0 Research Area: Neuroscience, Stem Cells, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO3-Specific

anti- ROBO4-Specific antibody
FNab07375	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: roundabout homolog 4, magic roundabout(Drosophila) Uniprot ID: Q8WZ75 Research Area: Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO4-Specific

anti- ROCK1-Specific antibody
FNab07377	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:3000 IHC: 1:20-1:200 Immunogen: Rho-associated, coiled-coil containing protein kinase 1 Uniprot ID: Q13464 Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology, Cell Division Show more
Description: Antibody raised against ROCK1-Specific

anti- ROCK2-Specific antibody
FNab07379	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: Rho-associated, coiled-coil containing protein kinase 2 Uniprot ID: O75116 Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biolog Show more
Description: Antibody raised against ROCK2-Specific

anti- RRM1-Specific antibody
FNab07495	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IF: 1:10-1:100 Immunogen: ribonucleotide reductase M1 Uniprot ID: P23921 Gene ID: 6240 Research Area: Cancer, Immunology, Metabolism
Description: Antibody raised against RRM1-Specific

anti- RtcB-Specific antibody
FNab07515	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IP: 1:500-1:1000 IF: 1:10-1:100 Immunogen: chromosome 22 open reading frame 28 Uniprot ID: Q9Y3I0
Description: Antibody raised against RtcB-Specific

anti- SEC61B-Specific antibody
FNab07691	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IF: 1:20-1:200 IHC: 1:20-1:200 Immunogen: Sec61 beta subunit Uniprot ID: P60468 Research Area: Metabolism
Description: Antibody raised against SEC61B-Specific

anti- SENP5-Specific antibody
FNab07714	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: SUMO1/sentrin specific peptidase 5 Uniprot ID: Q96HI0 Research Area: Metabolism
Description: Antibody raised against SENP5-Specific

anti- SERINC2-Specific antibody
FNab07736	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: serine incorporator 2 Uniprot ID: Q96SA4 Research Area: Metabolism
Description: Antibody raised against SERINC2-Specific

anti- SIRT2-Specific antibody
FNab07880	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: sirtuin(silent mating type information regulation 2 homolog) 2(S. cerevisiae) Uniprot ID: Q8IXJ6 Research Area: Epigenetics, Metabolism
Description: Antibody raised against SIRT2-Specific

anti- SLC12A5-Specific antibody
FNab07908	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: solute carrier family 12(potassium-chloride transporter), member 5 Uniprot ID: Q9H2X9 Research Area: Signal Transduction
Description: Antibody raised against SLC12A5-Specific

anti- SLC25A6-Specific antibody
FNab07947	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: solute carrier family 25(mitochondrial carrier adenine nucleotide translocator), member 6 Uniprot ID: P12236 Research Area: Metabolism
Description: Antibody raised against SLC25A6-Specific

anti- SMYD1-Specific antibody
FNab08047	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: SET and MYND domain containing 1 Uniprot ID: Q8NB12 Research Area: Metabolism
Description: Antibody raised against SMYD1-Specific

anti- Somatostatin-Specific antibody
FNab08109	FN Test	100µg	EUR 548.75
Recommended dilution: IHC: 1:4000-1:16000 Immunogen: somatostatin Uniprot ID: P61278 Research Area: Signal Transduction, Metabolism, Immunology, Cancer, Neuroscience, Stem Cells
Description: Antibody raised against Somatostatin-Specific

anti- SPAG4-Specific antibody
FNab08142	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: sperm associated antigen 4 Uniprot ID: Q9NPE6 Research Area: Developmental biology
Description: Antibody raised against SPAG4-Specific

anti- SPIN1-Specific antibody
FNab08178	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: spindlin 1 Uniprot ID: Q9Y657 Research Area: Developmental biology
Description: Antibody raised against SPIN1-Specific

anti- SPTBN1-Specific antibody
FNab08204	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IP:1:200-1:2000 IHC: 1:20-1:200 Immunogen: spectrin, beta, non-erythrocytic 1 Uniprot ID: Q01082 Research Area: Signal Transduction
Description: Antibody raised against SPTBN1-Specific

anti- SRGAP3-Specific antibody
FNab08227	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: SLIT-ROBO Rho GTPase activating protein 3 Uniprot ID: O43295 Research Area: Signal Transduction
Description: Antibody raised against SRGAP3-Specific

anti- ST8SIA2-Specific antibody
FNab08276	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 Uniprot ID: Q92186 Research Area: Metabolism, Developmental biology
Description: Antibody raised against ST8SIA2-Specific

anti- STEAP2-Specific antibody
FNab08317	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: six transmembrane epithelial antigen of the prostate 2 Uniprot ID: Q8NFT2 Research Area: Metabolism
Description: Antibody raised against STEAP2-Specific

anti- SYN1-Specific antibody
FNab08416	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:20000 IP: 1:1000-1:10000 Immunogen: synapsin I Uniprot ID: P17600 Research Area: Neuroscience, Metabolism
Description: Antibody raised against SYN1-Specific

p53 standing dictates responses of B lymphomas to monotherapy with proteasome inhibitors.

The proapoptotic perform of p53 is assumed to underlie most anticancer modalities and can be activated in response to oncogenic insults, resembling overexpression of the Myc oncoprotein. Right here we generated tractable B lymphomas utilizing retroviral transduction of the MYC oncogene into hematopoietic cells with 2 knock-in alleles encoding a fusion between p53 and 4-hydroxytamoxifen (4OHT) receptor (p53ER(TAM)).

 

In these polyclonal tumors, Myc is the one oncogenic lesion, and p53ER(TAM) standing will be quickly toggled between “off” and “on” with 4OHT, supplied that the Trp53 promoter has been independently activated. Though 4OHT can set off widespread apoptosis and overt tumor regression even within the absence of DNA-damaging brokers, in tumors with excessive ranges of Mdm2 these responses are blunted.

 

Nevertheless, cotreatment with proteasome inhibitors absolutely restores therapeutic results in vivo. Equally, human Burkitt lymphomas with wild-type p53 and overexpression of Hdm2 are extremely delicate to proteasome inhibitors, except p53 ranges are lowered utilizing the HPV-E6 ubiquitin ligase. Due to this fact, proteasome inhibitors could possibly be extremely efficient as a monotherapy towards Myc-induced lymphomas, without having for adjuvant chemotherapy or radiation remedy. Then again, their efficacy is crucially depending on the wild-type p53 standing of the tumor, putting vital restrictions on affected person choice

 

 

anti- STAT3 antibody
FNab08299	FN Test	100µg	EUR 548.75
Immunogen: signal transducer and activator of transcription 3(acute-phase response factor) Uniprot ID: P40763 Gene ID: 6774 Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Immunology, Cancer, Developmental biology, Stem C Show more
Description: Antibody raised against STAT3

anti- STAT3 antibody
FNab08300	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:20000 IP: 1:1000-1:10000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: signal transducer and activator of transcription 3(acute-phase response factor) Uniprot ID: P40763 Gene ID: 6774 Research Area: Epigenetics, Sign Show more
Description: Antibody raised against STAT3

Anti-STAT3 Antibody
PA1108	BosterBio	100ug/vial	EUR 334

Anti-STAT3 Antibody
PA1778	BosterBio	100ug/vial	EUR 334

Anti-STAT3 antibody
PAab08298	Lifescience Market	100 ug	EUR 386

Anti-STAT3 antibody
PAab08299	Lifescience Market	100 ug	EUR 386

Anti-STAT3 Antibody
PB9511	BosterBio	100ug/vial	EUR 294

Anti-STAT3 antibody
STJ27462	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-STAT3 antibody
STJ113436	St John's Laboratory	50 µl	EUR 287
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-STAT3 antibody
STJ113737	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-STAT3 antibody
STJ118189	St John's Laboratory	100 µl	EUR 277

Anti-STAT3 antibody
STJ119281	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-STAT3 antibody
STJ29841	St John's Laboratory	100 µl	EUR 413
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-Stat3 antibody
STJ95808	St John's Laboratory	200 µl	EUR 197
Description: Stat3 is a protein encoded by the STAT3 gene which is approximately 88 kDa. Stat3 is localised to the cytoplasm and nucleus. It is involved in the immune response IL-23 signalling pathway, RET signalling, Th17 cell differentiation and prolactin signalling pathway. This protein falls under the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. Stat3 is expressed in the heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Mutations in the STAT3 gene may result in Hyperimmunoglobulin E recurrent infection syndrome. STJ95808 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of Stat3 protein.

Anti-Stat3 antibody
STJ95809	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Stat3.

Anti-Stat3 antibody
STJ95810	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Stat3.

Anti-STAT3 antibody
STJ70982	St John's Laboratory	100 µg	EUR 359

Anti-Stat3 antibody
STJ97467	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Stat3.

Anti-Stat3 antibody
STJ97468	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Stat3.

Anti-STAT3 antibody
STJ97520	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to STAT3 (1E3).

Anti-STAT3 antibody
STJ97525	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to STAT3 (3F4).

Anti-Stat3 antibody
STJ98399	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Stat3.

Anti-Stat3 antibody
STJ98400	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Stat3.

Anti-STAT3 Antibody
STJ503137	St John's Laboratory	100 µg	EUR 476

Anti-STAT3 antibody
STJ99212	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to STAT3.

anti-STAT3
YF-PA14814	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to STAT3

Anti-Phospho-STAT3 Antibody
STJ502696	St John's Laboratory	100 µg	EUR 586

Anti-STAT3 Antibody (Biotin)
STJ503138	St John's Laboratory	100 µg	EUR 586

Anti-STAT3 Antibody (FITC)
STJ503139	St John's Laboratory	100 µg	EUR 586

anti-STAT3 (7G3H4)
LF-MA30243	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to STAT3

anti-STAT3 (3B5)
LF-MA30485	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to STAT3

Anti-STAT3 (4D6)
YF-MA10886	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STAT3

Polyclonal Goat Anti-STAT3 Antibody
APG00319G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-STAT3 . This antibody is tested and proven to work in the following applications:

Anti-STAT3 Rabbit Monoclonal Antibody
M00007	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody
M00007-1	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody
M00007-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Phospho-STAT3-(Y705) antibody
STJ27511	St John's Laboratory	100 µl	EUR 393
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-Phospho-STAT3-(S727) antibody
STJ116371	St John's Laboratory	100 µl	EUR 393
Description: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-Phospho-Stat3 (S727) antibody
STJ90410	St John's Laboratory	200 µl	EUR 197
Description: Stat3 is a protein encoded by the STAT3 gene which is approximately 88 kDa. Stat3 is localised to the cytoplasm and nucleus. It is involved in the immune response IL-23 signalling pathway, RET signalling, Th17 cell differentiation and prolactin signalling pathway. This protein falls under the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. Stat3 is expressed in the heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Mutations in the STAT3 gene may result in Hyperimmunoglobulin E recurrent infection syndrome. STJ90410 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This primary antibody specifically binds to endogenous Stat3 protein which only binds about S727 when S727 is phosphorylated.

Anti-Phospho-Stat3 (Y705) antibody
STJ90411	St John's Laboratory	200 µl	EUR 197
Description: Stat3 is a protein encoded by the STAT3 gene which is approximately 88 kDa. Stat3 is localised to the cytoplasm and nucleus. It is involved in the immune response IL-23 signalling pathway, RET signalling, Th17 cell differentiation and prolactin signalling pathway. This protein falls under the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. Stat3 is expressed in the heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Mutations in the STAT3 gene may result in Hyperimmunoglobulin E recurrent infection syndrome. STJ90411 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This primary antibody specifically binds to endogenous Stat3 protein which only binds about Y705 when Y705 is phosphorylated.

Anti-Stat3 (Acetyl-Lys49) Antibody
STJ193228	St John's Laboratory	200 µl	EUR 197

Anti-Stat3 (Acetyl Lys87) antibody
STJ97699	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Stat3 (Acetyl Lys87).

Anti-Phospho-Stat3 (Y705) antibody
STJ97747	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to Phospho-Stat3 (Y705).

Anti-Phospho-STAT3 Antibody BIOTIN
STJ502697	St John's Laboratory	100 µg	EUR 645

Anti-Phospho-STAT3 Antibody FITC
STJ502698	St John's Laboratory	100 µg	EUR 645

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Hu-48T	DL Develop	48T	EUR 498
Should the Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Hu-96T	DL Develop	96T	EUR 647
Should the Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
DLR-STAT3-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Signal Transducer And Activator Of Transcription 3 (STAT3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RD-STAT3-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Signal Transducer And Activator Of Transcription 3 (STAT3) ELISA Kit
RDR-STAT3-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Stat3 antibody
20R-1593	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Stat3 antibody

Stat3 antibody
20R-1597	Fitzgerald	100 ug	EUR 705
Description: Rabbit polyclonal Stat3 antibody

STAT3 antibody
20R-1911	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
20R-1912	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
20R-2227	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
20R-2228	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
70R-11848	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
70R-20573	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
70R-31708	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal STAT3 antibody

STAT3 antibody
70R-13773	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal STAT3 antibody

STAT3 antibody
70R-14315	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal STAT3 antibody

Stat3 Antibody
3470R-100	Biovision		EUR 316

Stat3 Antibody
3470R-30T	Biovision		EUR 146

STAT3 antibody
10R-2073	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal STAT3 antibody

STAT3 antibody
10R-2269	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal STAT3 antibody

STAT3 antibody
10R-1224	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal STAT3 antibody

STAT3 antibody
10R-5956	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal STAT3 antibody

STAT3 Antibody
48732-100ul	SAB	100ul	EUR 333

STAT3 Antibody
48732-50ul	SAB	50ul	EUR 239

Stat3 Antibody
48780-100ul	SAB	100ul	EUR 333

Stat3 Antibody
48780-50ul	SAB	50ul	EUR 239